Race 1 of Fusarium oxysporum f. sp. cubense: the threat of banana cultivation in Central and Eastern Kenya

Abstract

Background

Fusarium wilt (Panama disease) caused by Fusarium oxysporum f. sp. cubense (Foc) is of economic importance in Kenya. The disease is widespread and currently causing havoc to bananas in the main growing regions of Eastern and Central Kenya. There is no information on the pathotypes associated with the spate of infections observed in these regions. This study was undertaken to identify the races of the pathogen involved and their pathogenicity on banana.

Methods

A total of 41 Foc isolates were collected from symptomatic banana plants in Central Kenya. The Fusarium strains isolated were identified based on morphological characteristics and screened using a PCR-based assay with race-specific primers for Foc races 1, 2, and 4. We further evaluated the pathogenicity of a subset of 24 isolates on the banana variety Gros Mitchel, a universally susceptible variety to Fusarium wilt. Conidia were harvested from 14-days-old Foc cultures grown on Potato Dextrose Agar (PDA) and inoculated onto eight-weeks-old tissue-cultured banana seedlings by dipping the seedlings into the inoculum solution. Disease severity was assessed weekly by the extent of chlorosis and vascular discoloration and at the end of the experiment, 140 days post-inoculation, respectively. Root and shoot dry weights were collected at the end of the experiment. The experiment was undertaken using the randomized complete block design (RCBD) experimental design with four replicates and repeated twice. The collected data were subjected to ANOVA and area under disease progress stairs to determine the virulence of the isolates.

Results

Our results indicate that all the 24 isolates were pathogenic to Gross Mitchel to a varying extent and 29 isolates belonged to race 1 of the pathogen. Twelve isolates tested negative for race 1, race 2 and race 4.

Conclusions

The Fusarium isolates tested in this study belonged mainly to Foc race 1, except 12 isolates which tested negative using Foc specific primers. There is a need to investigate the isolates further, with VCGs and sequencing studies, as well as to characterize their virulence on the differential set of banana varieties.

Background

Bananas (Musa spp.) provide more than 25% of the total dietary calories in Africa and are rich in carbohydrates, starch, sugar, vitamins, and minerals (Borges et al. 2020). In Kenya, banana fruits are the leading horticultural crop in volume and value and contribute 17.8% of the total value of domestic horticulture and 34.5% of all fruits (Ntabo et al. 2024). According to the Agriculture and Food Authority (AFA) report, 72,486 Ha were under production in 2020, generating 1,871,521 metric tons of produce valued at KES 29,028,891,206 (approximately 236 M USD). Regarding value, the top counties are Meru, Taita Taveta, Muranga, Kirinyaga, and Kisii, which contribute 23.6%, 9.7%, 7.93%, 7.83%, and 5.4% of the total value of the fruits respectively (AFA 2022). The main banana varieties cultivated in Kenya include ripening varieties such as Apple, Giant Cavendish, Dwarf Cavendish, Williams, Grand Nain, Vallery, FHIA 23, FHIA 17, and Lacatan. Cooking varieties cultivated include Ng’ombe, Nusu Ngombe, Kampala, Mkono wa Tembo, Bokoboko, and Uganda green (MOALF/Shep Plus 2019; KALRO 2019).

One of the major production challenges facing banana production in Kenya is the occurrence of pests and diseases. Fusarium wilt (Panama disease) is caused by Fusarium oxysporum f. sp. cubense (Foc). It is Kenya’s most serious banana disease (Kung’u and Jeffries 2001) and worldwide (Kema et al. 2021; Staver et al. 2020). Globally, in the year 2020, economic losses to the tune of US$18.2 billion are attributable to the disease. In Kenya, a recent report indicates a disease prevalence of up to 80% in Kisii County (Momanyi et al. 2021).

The symptoms are characterized by reddish-brown discoloration of the xylem, starting from feeder roots and progressing toward the rhizome and the pseudostem. Infected banana pseudostem forms brown, red, or yellow rings, and the leaves begin to yellow, starting from the margins to the midrib. The infected leaves collapse at the base of the petiole and hang on the pseudostem forming a skirt-like appearance (Dita et al. 2018). The fungus may remain dormant in the soil for many years in the form of persistent chlamydospores and is, therefore, difficult to eliminate once established in the soil (Maryani et al. 2019). The disease spreads through various pathways, including infected planting material, runoff water, and movement by workers (Conde 2001). In addition, the disease may also be spread by insects such as banana weevils (Cosmopolites sordidus) (Ploetz 2015).

The virulence of Foc isolates is cultivar specific and comprises races that infect specific varieties. For example, race 1 of the pathogen infects the Gros Michel (AAA), Manzano/Apple/Latundan (Silk AAB) race 2 infects Bluggoe sub group (ABB) (cooking bananas), Race 4 infects Cavendish sub group (AAA) in addition to Gros Michel and Bluggoe banana varieties. Race 4 is further sub-divided into tropical race 4 (TR4) and sub-tropical race 4 (STR4) with the latter infecting Cavendish only under the sub-optimal growth temperatures in the sub-tropics e.g. South Africa and Australia (Dita et al. 2018). Tropical race 4 is the most destructive pathogen and was first reported in Southeast Asia in between 1960’s and 1970’s. The race has since spread to many banana-growing countries, including Laos, Vietnam, Taiwan, Malaysia, Borneo, Indonesia, mainland China, Philippines, Jordan, Pakistan, Lebanon, Oman, Latin America and the Caribbean, and India (Staver 2017). In Africa, the race TR4 pathogen has only been reported in Mozambique and Comoros (Mmadi et al. 2023; Viljoen et al. 2020) and STR4 in South Africa (Matthews et al. 2020). Race 4 was also reported in Colombia in 2019, in Peru 2021, and later reported in Venezuela in the year 2023 (Martinez et al. 2023).

In Kenya, races 1 and 2 have previously been reported (Kung’u and Jeffries 2001). The study by Kung’u and Jeffries (2001) assigned 17 isolates to either race 1 or 2, and 12 isolates could not be assigned to either race 1 or 2. Although virulence assays and VCG analysis play an important role in defining the virulence diversity of Foc, developments in molecular diagnostics have made it possible to accurately and efficiently define the virulence diversity of the pathogen (Thangavelu et al. 2021).

Since the initial reports by Kung’u and Jeffries (2001) on Foc diversity in Kenya, there have been no subsequent studies to monitor the diversity of the pathogen. This study was conducted in the banana-growing counties of Central and Eastern Kenya to determine the physiological races of the pathogen involved in the region's current outbreak of Fusarium wilt. The findings indicate that the disease is prevalent in the dessert and cooking bananas and is fueled by race 1 of the pathogen.

Materials and methods

Isolation, identification, and preservation of the pathogen

The isolates were collected from six banana growing Counties in Central and Eastern parts of Kenya: Nyeri, Kirinyaga, Embu, Tharaka Nithi, Kiambu, and Murang’a. A total of Fifty seven rhizome and root samples of banana plants symptomatic of Foc were collected from farmers’ fields using a purposive sampling technique. The geographical location and varieties from which the samples were collected are shown in Table 1. The root tissues from symptomatic plants were washed in running water and surface sterilized with 1% sodium hypochlorite solution for 1 min before rinsing in sterile distilled water. The roots were cut into small pieces of about 2 mm and plated onto water agar and incubated for five days at 25 °C. The colonies were then transferred into Potato Dextrose Agar (PDA) media and incubated at 25 °C for seven days. The isolates were identified morphologically using a compound microscope as described by Nelson et al. (1983). The fungal cultures were preserved on filter papers at − 5 °C for further use as described by Fong et al. (2000).

Table 1 The study area and banana description

Bioassays and disease assessment

A total of 24 isolates were randomly selected for pathogenicity test. The test was done on Gros Michel banana variety to determine whether the isolates are virulent. The greenhouse experiments were conducted at KALRO–CRI facility in Ruiru, located 1620 m above sea level. Conidia were harvested and enumerated as described by García-Bastidas et al. (2019). The conidia were harvested from 14-days-old cultures grown on PDA by adding 15 mL of sterile distilled water into the petri dish and gently scraping off the mycelium to release the Foc spores. The spore suspension was filtered through two-layered cheesecloth, and spores were counted using the hemocytometer. The spore concentration was adjusted to 10⁷ spores /mL by diluting it with sterile distilled water.

The pathogenicity test was carried out according to Dita et al. (2014). To expose the roots, the soil was gently removed from two-month-old tissue-cultured banana seedlings (cv. Gros Michel). The banana roots were trimmed at the tips and immersed into the prepared Foc spore suspension for 30 min. The plants were then planted into the soil containing topsoil, manure, and river sand in a ratio of 3:2:1. The control comprised of banana plants immersed in sterile distilled water. The experiment was laid in a randomized complete block design (RCBD) with treatments replicated three times. Each replication comprised four banana seedlings. The experiment was repeated twice.

External disease severity was assessed seven days post inoculation and once per week on a scale of 1–5 depending on the extent of chlorosis where one indicated no symptom was observed, two initial yellowing on the lower leaves, three all of the lower leaves have become yellow, and some of the younger leaves have also been discolored, four intense yellowing on all leaves, five plants dead/complete wilting as described by Pérez Vicente et al. (2014). In addition, internal symptoms were assessed once at 140 days post inoculation by assessing the extent of vascular discoloration where one indicated no symptoms, two initial rhizome discolorations, three slight discolorations of the rhizome throughout the vascular system, four rhizomes with necrosis in the majority of the interior tissues, and five entire rhizomes necrotic as described by Pérez Vicente et al. (2014). The plant root and shoot dry weight were assessed 140 days after inoculation at the end of the experiment.

Molecular identification of Foc races using Foc-specific primers

Genomic DNA extraction, quantification, and preservation

Seven- days old single spore fungal cultures were used in this study. The DNA was extracted using the mixed alkyl trimethyl ammonium bromide (MATAB) method described by Diniz et al. (2005). On PDA, ten ml of 0.01% teepol was added to the petri-dish containing fungal mycelia. The mycelia on PDA media were scrapped using a scalpel, and 0.5 gm was weighed and placed in a mortar. One milliliter of each lysis buffer and extraction buffer was added to the mycelia and crushed using a pestle and Mortar. The mixture was transferred to 2 ml Eppendorf tubes and incubated in a water bath at 62 °C for 30 min with regular shaking at an interval of ten minutes. After incubation, 1 ml of chloroform/isoamyl alcohol mixture (24:1) was added to each Eppendorf tube and vigorously shaken and centrifuged at 13,000 rpm for ten minutes in a desktop micro-centrifuge. The supernatants were carefully pipetted out into new 2 ml Eppendorf tubes. Ten µl of RNase (10 mg/ml) was added to the supernatants and incubated in a water bath at 37 °C for 30 min to remove the RNA. A volume of isopropyl alcohol equal to the volume of each supernatant was added into each Eppendorf tube and mixed gently by inverting the tubes several times. The mixture was incubated at − 20 °C overnight to precipitate DNA. The suspended DNA was centrifuged at 14,000 rpm for ten minutes, and the supernatant was carefully discarded. The pellets were washed with 200 µl of 70% ethanol. The pellets were air-dried for one hour and dissolved in 50 µl of TE (Tris–EDTA). The DNA was stored at -20 °C for future use. The quantity and quality of DNA were evaluated by spectrophotometry and gel electrophoresis.

Amplification of Foc genomic DNA using Foc-specific primers

The Foc genomic was region amplified using Foc-specific primers based on the method described by Thangavelu et al. (2022). To identify race 1 of the pathogen, primer combination FocR1F (TACCTCCTTGGTCGACAGGT) and FocR1R (CAGACTTCCAACGTCTCGGT) were used to amplify a hypothetical protein (XM_018394505.1) of 320 bp length (Thangavelu et al. 2022). To identify lineage VI of the pathogen, primer combination FocLin6bF (CGACAATGAGCTTATCTGCCATT) and FocLin6bR (CATCGAGGTTGTGAGAATGGA) were used to amplify TEF-1α gene (KY436227) of 300 bp length (Ndayihanzamaso et al. 2020). Primer combination of FocR4F (CGCACTCTTACGTTGAGGAT) and FocR4R (TCCACGCAACACTAGCTACT) were used to amplify the SIX8a gene (KF548063.1) was used to identify Foc race 4 (Thangavelu et al. 2022).

PCR reactions were performed as follows: 12.5 μl Red Mix (Taq inqaba), 100 ng of template DNA, 0.5 µM each of forward and reverse primers, and 1.5 μl nuclease-free water to a total volume of 25 μl. PCR amplification was carried out using a Techne flexigene thermal cycler®. An initial denaturation step at 95 ℃ for 5 min was followed by 45 cycles of PCR cycling parameters: 94 ℃ for 60 s, 34 ℃ for 60 s, and 72 ℃ for 90 s followed by a final extension at 72 ℃ for 10 min. Positive controls were used in all the PCR tests. The positive controls were DNA of Foc STR4, Foc lineage VI and Foc TR4. All the positive controls were kindly provided by Dr. Diane Mostert (Stellenbosch University, department of Plant Pathology, South Africa).

The PCR products were electrophoresed in 1.8% agarose gel. It was stained in ethidium bromide solution and then visualized in a UV trans-illuminator. The PCR amplifications were repeated twice to confirm if the results were consistent.

Data analysis

The Area under disease progress stairs (AUDPS) was calculated following the method by Simko and Piepho (2012). $\text{AUDPS}={\sum }_{\text{i}=1}^{\text{n}}\left(\frac{{\text{D}}_{\text{i}} + {\text{D}}_{\text{i}-1} }{2}\times ({\text{T}}_{\text{i}}-{\text{T}}_{\text{i}-1})\right),$ where D_i is disease severity score at the time of recording, D_i₋₁ is disease severity score at the previous time of recording, T_i is the current time of recording, T_i₋₁ is the previous time of recording while n is the total number of recordings. Results from the bioassays and disease assessment were subjected to analysis of variance (ANOVA) was carried out using R statistical software version 4.2.2. Means that were significantly different were separated using Tukey Honest Significant Difference (HSD) method. All statistical tests were performed at a 0.05 significance level.

Results

Virulence of Fusarium oxysporum f. sp. cubense isolates

All plants inoculated with the isolates exhibited yellowing of the leaves and discoloration of the internal vascular tissues (Fig. 1).

Fig. 1

Fusarium wilt internal and external symptoms progression on Gros Michel infected banana variety. A indicates No symptoms on uninfected banana variety, B indicates initial rhizome discoloration and yellowing notably on the lower leaves, C indicates slight discoloration of the rhizome throughout the vascular system and most of the lower leaves have become yellow, D shows rhizome with necrosis in the majority of the interior tissues and wilting on all leaves, while E indicates rhizome totally necrotic, complete wilting/Plant dead

The fungal isolates from symptomatic Gros Michel banana plants were identified as Foc based on their morphology.

There was a significant difference between the pathogen-inoculated plants and the negative control (non-pathogen inoculated) (P < 0.001). All the isolates tested were pathogenic to the variety Gross Michel with virulence varying with the isolates (Table 2 and Fig. 2). For example, for the most aggressive isolates, AP009 recorded the highest disease severity (4.25) and lowest shoot dry weight (8.78 g) and root dry weight (10.75 g) (Table 3) compared to the control treatment. Isolate CV005 recorded a 153% increase in the area under disease stairs compared to the negative control. The least virulent isolate, AP005 recorded the lowest disease severity (1.5) and the highest shoot dry weight (18.35) and root dry weight (21.20). The same isolate had an increase in the area under disease progress stairs compared to the controls. The majority of the isolates had a statistically similar area under disease progression. However, isolate CV005, KL0002, and KL004 had the highest area under disease progression stairs compared to most isolates. Similarly, isolates CV005 and AP009 had the highest vascular discoloration levels compared to most of the isolates (Table 2 and Fig. 2).

Table 2 Severity of Fusarium wilt in banana cv. Gross Michel inoculated with different Foc isolates

Fig. 2

Severity of Fusarium wilt in banana cv. Gross Michel inoculated with different isolates. The table shows external symptoms showing area under disease progress stairs. Solid boxes indicate average means from two experiments and the 95% confidence intervals. The Means were separated by the Tukey HSD test (α = 0.05). Means marked with the same letter within the graph are not statistically different

Table 3 The table indicates data on shoot and root dry weight

Molecular identification of isolates

Twenty nine Fusarium oxysporum isolates out of 41 were amplified by a specific primer for Foc Lineage VI, with primer combination of FocLin6bF (CGACAATGAGCTTATCTGCCATT) and FocLin6bR (CATCGAGGTTGTGAGAATGGA) at a band size of 300 bp (Fig. 3 and Table 4).

Fig. 3

PCR amplification of Foc races using Foc Lineage VI specific primer. Lane 1-41 indicates Foc isolates. P1 indicates positive control for Foc STR4. P2 indicates positive control for Foc lineage VI. P3 indicates positive control for Foc TR4. N1 indicates Rxn mix-DNA. N2 indicates Rxn mix + DH2O respectively. M indicates 100 bp ladders

Table 4 PCR amplification of Foc races using Foc Lineage VI specific primer

The same 29 isolates that were amplified with a specific primer for Foc Lineage VI were also amplified with a specific primer for Foc race 1 with primer combination FocR1F (TACCTCCTTGGTCGACAGGT) and FocR1R (CAGACTTCCAACGTCTCGGT) that amplified a band size of 320 bp (Fig. 4 and Table 5).

Fig. 4

PCR amplification of Foc races using Foc race 1 specific primer. Lane 1- 41 indicates Foc isolates. P1 indicates positive control for Foc STR4. P2 indicates positive control for Foc TR4. P3 indicates positive control for Foc race 1. N1 indicates Rxn mix-DNA. N2 indicates Rxn mix + DH2O respectively. M indicates 100 bp ladders

Table 5 PCR amplification of Foc races using Foc race 1 specific primer

The specific primers did not amplify 12 isolates. No isolate was amplified by the specific primer for Foc race 4 except the positive controls TR4 and STR4 that were amplified by the specific primer with Primer combination of FocR4F (CGCACTCTTACGTTGAGGAT) and FocR4R (TCCACGCAACACTAGCTACT) (Fig. 5).

Fig. 5

PCR amplification of Foc races using Foc race 4 specific primer. Lane 1- 21 indicates Foc isolates. P1 indicates positive control for Foc race 1. P2 indicates positive control for Foc STR4. P3 indicates positive control for Foc TR4. N1 indicates Rxn mix-DNA.N2 indicates Rxn mix + DH2O respectively). M indicates 100 bp ladders

Discussion

Strains of F. oxysporum exhibited a narrow range of pathogenicity towards selected host plants, with strains infecting the same plant species belonging to the same group and referred to as forma specialis Edel-Hermann and Lecomte (2019). Our study findings indicate that all the isolates used in the study were pathogenic to banana cv. Gros Mitchel, with the level of virulence varying depending on the isolate. The evolution of fungi is determined by evolutionary forces such as mutations, natural selection, genetic drift, gene flow, and mating systems (Fourie et al. 2011). Evolution resulting in gained virulence is a continuous process driven by the accumulation of mutations, as exemplified in F.oxysporum f. sp. vasinfectum (Wang et al. 2008). According to Guo et al. (2014), Foc race 4 gained virulence through the expansion of gene families of transporters and transcription factors associated with the transport of toxins and nutrients, enabling the pathogen to adapt to the host environment and contribute to enhanced virulence. Fusarium oxysporum can transfer specific chromosomes, which may harbor specific pathogenicity genes, leading to new pathogenic lineages (Maryani et al. 2019; Fourie et al. 2009). Taken together, these findings indicate that various molecular processes underpin changes in virulence in phytopathogens. The differences in pathogenicity observed in our study could be due to variations in molecular determinants conditioning pathogenicity in Foc. Further research should aim at understanding these molecular determinants among the isolates.

The Foc-specific markers used in this study have previously been reported by other studies and are reliable in race identification among Foc isolates (Ndayihanzamaso et al. 2020; Thangavelu et al. 2022). Our study indicates that race 1 is the most prevalent strain fueling the current spread of Fusarium wilt in Central Kenya and Eastern Kenya. A similar study by Kung’u and Jeffries (2001) indicated the occurrence of race 1 and race 2 in samples collected from Kenya's Coastal, Central, and Western regions. The dominance of race 1, as reported in our study, could be because most of the isolates were obtained from dessert bananas which have been reported to harbor race 1 of Foc (Arinaitwe et al. 2019). Importantly, our study findings indicated that none of the collected isolates belongs to race 4, consistent with findings by Kung’u and Jeffries (2001).

Twelve Foc isolates failed to amplify with any of the primers tested despite a repeat in DNA extraction and PCR amplification. Nevertheless, Foc race 1 is not considered a single clonal lineage and strains associated with race 1 are linked to 22 vegetative compatibility groups (VCGs) (Fourie et al. 2011; Mostert et al. 2022) and 7 new species (Maryani et al. 2019; Vezina et al. 2021). It is, therefore, recommended for a VCG characterization and sequencing study to be conducted on the Kenyan isolates.

The findings of this study contribute valuable information to better understanding of Fusarium wilt in Kenya. The absence of race 4 means that farmers can deploy resistance to manage the disease. The use of a Cavendish type of bananas, e.g., varieties Grand nain, Williams, and Chinese dwarf, is the most sustainable strategy for the management of Fusarium wilt in areas free of the race. Before the emergence of race 4 in Central America, the deployment of the resistant Cavendish completely halted the Fusarium wilt epidemic, which had completely wiped out the susceptible Gros Mitchel banana variety (Maryani et al. 2019). Deployment of a similar approach in the disease-affected areas of Kenya is expected to halt the further spread of the disease.

Our identification of Foc race 1 in Central and Eastern Kenya suggests an opportunity for disease management through the deployment of resistant banana varieties. This finding aligns with studies in other regions (Rodríguez-Yzquierdo et al. 2023a, b; Martinez et al. 2023), where the absence of specific races has facilitated the use of resistant cultivars as an effective control measure. By planting resistant varieties such as Cavendish, farmers in Kenya can mitigate the impact of Fusarium wilt on banana cultivation.

Understanding the soil factors associated with Fusarium wilt incidence, as explored in studies by Olivares et al. (2022), Campos et al. (2021), Olivares et al. (2021), and Campos (2023) is also crucial for developing holistic disease management strategies.

Conclusions

The Fusarium isolates tested in this study belonged mainly to Foc race 1, except 12 isolates which tested negative using Foc specific primers. There is a need to investigate the isolates further, with VCGs and sequencing studies, as well as to characterize their virulence on the differential set of banana varieties.